Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17259711

Xenopus ORFeome
What is the ORFeome?

ORF Name:rab7b.L ORF1 Species: laevis
Gene Symbol: rab7b.L Entrez Gene ID: 444172
Gene Synonyms: loc100124979
Gene Name: RAB7B, member RAS oncogene family
Description: Ras-related GTPase
Plate: GDExl11040 Well: F03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827648
3' ORF Sequence: JZ827649
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80651 protein, mRNA (cDNA clone MGC:80651 IMAGE:5506849), complete cds
Template Accession: BC073279
GI: 49116805
Clone ID: IMAGE:5506849
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTCTGGAAATAAAGTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAACATGTGTTACTGTTAGAATC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers