Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17260311

Xenopus ORFeome
What is the ORFeome?

ORF Name:id2.S ORF1 Species: laevis
Gene Symbol: id2.S Entrez Gene ID: 447463
Gene Synonyms: xid2
Gene Name: inhibitor of DNA binding 2
Description: transcriptional regulator
Plate: GDExl11047 Well: A12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831224
3' ORF Sequence: JZ831225
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC81684 protein, mRNA (cDNA clone MGC:81684 IMAGE:6864738), complete cds
Template Accession: BC081029
GI: 51704026
Clone ID: IMAGE:6864738
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAAGCTTTCAGTCCAGTAAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGACAAAGGGATTTGCTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556