Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17260353

Xenopus ORFeome
What is the ORFeome?

ORF Name:loc100494782.L ORF1 Species: laevis
Gene Symbol: XB5902317.L [provisional:ces1c] Entrez Gene ID: 447725
Gene Synonyms: mgc81843
Gene Name: provisional ortholog of carboxylesterase 1C
Description: Carboxylesterase and related proteins
Plate: GDExl11049 Well: C02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831398
3' ORF Sequence: JZ831399
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: unknown
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC81843 protein, mRNA (cDNA clone MGC:81843 IMAGE:7008248), complete cds
Template Accession: BC082391
GI: 51950009
Clone ID: IMAGE:7008248
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGAAGGACAAGCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTATCTTAATCCAGACCAGATCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers