Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17260551

Xenopus ORFeome
What is the ORFeome?

ORF Name:MGC82205 ORF1 Species: laevis
Gene Symbol: thap1.S Entrez Gene ID: 446612
Gene Synonyms:
Gene Name: THAP domain containing, apoptosis associated protein 1
Description:
Plate: GDExl11029 Well: A07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825834
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: BC077429.1 Xenopus laevis MGC82205 protein, mRNA (cDNA clone MGC:82205 IMAGE:3402662), complete cds
Template Accession: BC077429
GI: 50415214
Clone ID: IMAGE:3402662
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCAATCGTGCTCAGCTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGAATGATTTCCTTATATGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556