Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17261025

Xenopus ORFeome
What is the ORFeome?

ORF Name:ascl1.S ORF1 Species: laevis
Gene Symbol: ascl1.S Entrez Gene ID: 444423
Gene Synonyms: ash1, mash1, xash1
Gene Name: achaete-scute family bHLH transcription factor 1
Description: HAND2 type transcription factor
Plate: GDExl11040 Well: D11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827860
3' ORF Sequence: JZ827859
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC83023 protein, mRNA (cDNA clone MGC:83023 IMAGE:5570622), complete cds
Template Accession: BC073667
GI: 49115938
Clone ID: IMAGE:5570622
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGACCTCCGCTGCCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAACCAAGTGGTGAAGTCGAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556