Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17261067

Xenopus ORFeome
What is the ORFeome?

ORF Name:cbx8.L ORF1 Species: laevis
Gene Symbol: cbx8.L Entrez Gene ID: 414709
Gene Synonyms:
Gene Name: chromobox 8
Description: chromatin binding
Plate: GDExl11025 Well: G04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825113
3' ORF Sequence: JZ830473
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC83092, mRNA (cDNA clone MGC:83092 IMAGE:6317262), complete cds
Template Accession: BC068898
GI: 46329608
Clone ID: IMAGE:6317262
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCTGTCCGCGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTTTTCTTCTTAAAGAAACC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers