Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17261607

Xenopus ORFeome
What is the ORFeome?

ORF Name:arl1.S ORF1 Species: laevis
Gene Symbol: arl1.S Entrez Gene ID: 447362
Gene Synonyms: arfl1
Gene Name: ADP ribosylation factor like GTPase 1
Description: GTP-binding ADP-ribosylation factor-like protein ARL1
Plate: GDExl11056 Well: F07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ832462
3' ORF Sequence: JZ832463
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84155 protein, mRNA (cDNA clone MGC:84155 IMAGE:6952056), complete cds
Template Accession: BC080081
GI: 51262002
Clone ID: IMAGE:6952056
Tissue: brain
Stage:
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGAATTTTGATTCTTGGTCTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGCCTACTCTTCAGGGATT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556