Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17262465

Xenopus ORFeome

ORF Name:Pa2g4 ORF1 Species: laevis
Gene Symbol: pa2g4.S Entrez Gene ID: 399238
Gene Synonyms: ebp1, hg4-1, p38-2g4
Gene Name: proliferation-associated 2G4
Description: Metallopeptidase
Plate: GDExl11069 Well: C04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core,
Source Bioscience


Sequences:
5' ORF Sequence: JZ834736
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis similar to proliferation-associated 2G4, 38kD, mRNA (cDNA clone MGC:81621 IMAGE:6863929), complete cds
Template Accession: BC084760
GI: 54311186
Clone ID: MGC:81621 IMAGE:6863929
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGGTGACGAAGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAGTGCCTTCATTTTCTTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556