Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17262579

Xenopus ORFeome

ORF Name:aadat ORF1 Species: laevis
Gene Symbol: aadat.S Entrez Gene ID: 432067
Gene Synonyms: aminoadipate aminotransferase, kat2, katii
Gene Name: aminoadipate aminotransferase
Description: Aromatic amino acid aminotransferase and related proteins
Plate: GDExl11024 Well: G05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ825002
3' ORF Sequence: JZ830368
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC80030, mRNA (cDNA clone MGC:80030 IMAGE:4030418), complete cds
Template Accession: BC071002
GI: 47507500
Clone ID: MGC:80030 IMAGE:4030418
Tissue: mesonephric kidney
Stage: frog
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTATGCACGTTTTATCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAACTGAAGAAAGTAATAGGGATC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556