Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17262585

Xenopus ORFeome
What is the ORFeome?

ORF Name:aaed1.S ORF1 Species: laevis
Gene Symbol: prxl2c.S Entrez Gene ID: 100049742
Gene Synonyms: aaed1
Gene Name: peroxiredoxin like 2C
Description: Uncharacterized conserved protein
Plate: GDExl11092 Well: A01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: No sequence available
3' ORF Sequence: JZ838866
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC100049742, mRNA (cDNA clone MGC:160834 IMAGE:7203494), complete cds
Template Accession: BC141727
GI: 146327067
Clone ID: IMAGE:7203494
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCAGCAACTCGCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACATCTACTATGACAGGTCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556