Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17262615

Xenopus ORFeome

ORF Name:aasdhppt ORF1 Species: laevis
Gene Symbol: aasdhppt.S Entrez Gene ID: 444812
Gene Synonyms:
Gene Name: aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Description: Alpha-aminoadipic semialdehyde dehydrogenase-phosphopantetheinyl transferase
Plate: GDExl11059 Well: G01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ832865
3' ORF Sequence: JZ832866
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84206 protein, mRNA (cDNA clone MGC:84206 IMAGE:6954613), complete cds
Template Accession: BC075207
GI: 49522933
Clone ID: MGC:84206 IMAGE:6954613
Tissue: brain
Stage: frog
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGCTCAGTGCCCTGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGACTTCTTCTTTGGCGAAAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556