Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17262855

Xenopus ORFeome
What is the ORFeome?

ORF Name:acat1.L ORF1 Species: laevis
Gene Symbol: acat1.L Entrez Gene ID: 414639
Gene Synonyms:
Gene Name: acetyl-CoA acetyltransferase 1
Description: Acetyl-CoA acetyltransferase
Plate: GDExl11026 Well: D09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825222
3' ORF Sequence: JZ825221
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Acetyl-CoA acetyltransferase A, mitochondrial, mRNA (cDNA clone MGC:81256 IMAGE:6631266), complete cds
Template Accession: BC068755
GI: 46249539
Clone ID: IMAGE:6631266
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTCTGCGGCACT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGCTTCTCAATCAGAACTGC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers