Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17263029

Xenopus ORFeome
What is the ORFeome?

ORF Name:actb.L ORF1 Species: laevis
Gene Symbol: actb.L Entrez Gene ID: 398459
Gene Synonyms: beta actin, beta-actin
Gene Name: actin, beta
Description: cytoskeletal constituent
Plate: GDExl11005 Well: A11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ840024
3' ORF Sequence: JZ840023
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: no
Original XGC clone QC Flag: yes



Template Information
Description: Xenopus laevis hypothetical protein MGC52661, mRNA (cDNA clone MGC:85343 IMAGE:6876400), complete cds
Template Accession: BC084121
GI: 54035187
Clone ID: IMAGE:6876400
Tissue: whole organism
Stage: NF stage 62
Clone Library: NICHD_XGC_Tad2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGACGATATTGCCGCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGCATTTACGGTGGACAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers