Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17263035

Xenopus ORFeome
What is the ORFeome?

ORF Name:actc1.L ORF1 Species: laevis
Gene Symbol: actc1.L Entrez Gene ID: 379752
Gene Synonyms: actc, actna1, cardiac actin, cardiac alpha actin, muscle actin
Gene Name: actin, alpha, cardiac muscle 1
Description: cytoskeletal constituent
Plate: GDExl11006 Well: D09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ840077
3' ORF Sequence: JZ840076
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis actin, alpha 1, skeletal muscle, mRNA (cDNA clone MGC:116510 IMAGE:6937969), complete cds
Template Accession: BC099316
GI: 68533977
Clone ID: IMAGE:6937969
Tissue: whole organism
Stage: NF stage 54 to prometamorphosis stage
Clone Library: NICHD_XGC_Tad1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTGACGACGAGGAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGCACTTCCTGTGCACAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556