Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17263137

Xenopus ORFeome
What is the ORFeome?

ORF Name:acvr2a.L ORF1 Species: laevis
Gene Symbol: acvr2a.L Entrez Gene ID: 399283
Gene Synonyms: actrii, acvr2, xar7, xstk9
Gene Name: activin A receptor type 2A
Description: transforming growth factor-beta receptor
Plate: GDExl11023 Well: B04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824936
3' ORF Sequence: JZ830304
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis activin receptor, mRNA (cDNA clone MGC:68440 IMAGE:6863868), complete cds
Template Accession: BC066770
GI: 44890634
Clone ID: IMAGE:6863868
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGCTGCTACCAAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGGCTTGATTCCTTGGGCGGAAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers