Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17263203

Xenopus ORFeome
What is the ORFeome?

ORF Name:adarb1.L ORF1 Species: laevis
Gene Symbol: adarb1.L Entrez Gene ID: 495438
Gene Synonyms:
Gene Name: adenosine deaminase, RNA-specific, B1
Description: tRNA-specific adenosine deaminase 1
Plate: GDExl11074 Well: G08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ835784
3' ORF Sequence: JZ835785
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: mixed
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis adenosine deaminase, mRNA (cDNA clone MGC:83973 IMAGE:6945275), complete cds
Template Accession: BC084960
GI: 54648472
Clone ID: IMAGE:6945275
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGTTGATGATGAAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACATTTAGAGAAAACTGGTCCTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers