Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17263347

Xenopus ORFeome
What is the ORFeome?

ORF Name:adrb2.L ORF1 Species: laevis
Gene Symbol: adrb2.L Entrez Gene ID: 444218
Gene Synonyms:
Gene Name: adrenoceptor beta 2
Description: glycoprotein hormone receptor
Plate: GDExl11040 Well: B09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827734
3' ORF Sequence: JZ827735
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80764 protein, mRNA (cDNA clone MGC:80764 IMAGE:5512669), complete cds
Template Accession: BC073349
GI: 49115392
Clone ID: IMAGE:5512669
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACGGTCGGTCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATAAGCAATCATGCGTGTTATG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers