Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17263599

Xenopus ORFeome
What is the ORFeome?

ORF Name:aida.S ORF1 Species: laevis
Gene Symbol: aida.S Entrez Gene ID: 398850
Gene Synonyms: aida-a, aida-b
Gene Name: axin interactor, dorsalization associated
Description:
Plate: GDExl11018 Well: E02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824452
3' ORF Sequence: JZ829806
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC68484, mRNA (cDNA clone MGC:68484 IMAGE:4030381), complete cds
Template Accession: BC059964
GI: 37747606
Clone ID: IMAGE:4030381
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGACATGAACAAGATCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCTTGAGCAGAGTCTGAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers