Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17263809

Xenopus ORFeome
What is the ORFeome?

ORF Name:aldh1a1.L ORF1 Species: laevis
Gene Symbol: aldh1a1.L Entrez Gene ID: 397728
Gene Synonyms: aldc, aldh-e1, aldh1, aldh11, pumb1, raldh1
Gene Name: aldehyde dehydrogenase 1 family member A1
Description: Aldehyde dehydrogenase
Plate: GDExl11030 Well: H03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825878
3' ORF Sequence: JZ825877
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis aldehyde dehydrogenase class 1, mRNA (cDNA clone MGC:79912 IMAGE:4031362), complete cds
Template Accession: BC076716
GI: 50368698
Clone ID: IMAGE:4031362
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGTGAAAACCCTTCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAATTCTTCTGTGAAATGTTCAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556