Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17263815

Xenopus ORFeome
What is the ORFeome?

ORF Name:aldh1a2.L ORF1 Species: laevis
Gene Symbol: aldh1a2.L Entrez Gene ID: 399389
Gene Synonyms: raldh-2, raldh2, xraldh2
Gene Name: aldehyde dehydrogenase 1 family member A2
Description: retinoid metabolism
Plate: GDExl11091 Well: E08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838742
3' ORF Sequence: JZ838741
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis RALDH2, mRNA (cDNA clone MGC:154559 IMAGE:8322299), complete cds
Template Accession: BC128678
GI: 118763685
Clone ID: IMAGE:8322299
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTTCCAGTAAAATAGAGATG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAATTCTTCTGGGGAATCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.0


Major funding for Xenbase is provided by grant P41 HD064556