Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17263839

Xenopus ORFeome
What is the ORFeome?

ORF Name:aldh3b1.L ORF1 Species: laevis
Gene Symbol: aldh3b1.L Entrez Gene ID: 447062
Gene Synonyms: aldh4, aldh7
Gene Name: aldehyde dehydrogenase 3 family member B1
Description: Aldehyde dehydrogenase
Plate: GDExl11053 Well: A07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ828747
3' ORF Sequence: JZ828748
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC83641 protein, mRNA (cDNA clone MGC:83641 IMAGE:5085062), complete cds
Template Accession: BC078120
GI: 50418394
Clone ID: IMAGE:5085062
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATAATGTCAAATCTTCCCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAGATGTGGCACAACCTTTTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556