Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17263857

Xenopus ORFeome
What is the ORFeome?

ORF Name:aldh9a1.S ORF1 Species: laevis
Gene Symbol: aldh9a1.S Entrez Gene ID: 379229
Gene Synonyms:
Gene Name: aldehyde dehydrogenase 9 family member A1
Description: Aldehyde dehydrogenase
Plate: GDExl11008 Well: F01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823554
3' ORF Sequence: JZ828852
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis similar to aldehyde dehydrogenase 9 family, member A1, mRNA (cDNA clone MGC:52697 IMAGE:4682691), complete cds
Template Accession: BC044080
GI: 28279849
Clone ID: IMAGE:4682691
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTCTCCTGCGAGCTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAAACCGACTCAACATTCCCCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers