Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17264175

Xenopus ORFeome
What is the ORFeome?

ORF Name:ankrd2.L ORF1 Species: laevis
Gene Symbol: ankrd2.L Entrez Gene ID: 380293
Gene Synonyms: ankrd2-a, ankrd2-b, arpp
Gene Name: ankyrin repeat domain 2 (stretch responsive muscle)
Description: Myotrophin and similar proteins
Plate: GDExl11007 Well: D06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823612
3' ORF Sequence: JZ828911
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis ankyrin repeat domain 2 (stretch responsive muscle), mRNA (cDNA clone MGC:52621 IMAGE:4681287), complete cds
Template Accession: BC044065
GI: 28278573
Clone ID: IMAGE:4681287
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGACGAAGTGAAATG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTGCTTCTCTGAAACAGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556