Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17264181

Xenopus ORFeome
What is the ORFeome?

ORF Name:ankrd2.S ORF1 Species: laevis
Gene Symbol: ankrd2.S Entrez Gene ID: 447042
Gene Synonyms: ankrd2-a, ankrd2-b, arpp
Gene Name: ankyrin repeat domain 2 (stretch responsive muscle)
Description: Myotrophin and similar proteins
Plate: GDExl11043 Well: H07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ828199
3' ORF Sequence: JZ828198
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis ankyrin repeat domain 2 (stretch responsive muscle), mRNA (cDNA clone MGC:83036 IMAGE:5571938), complete cds
Template Accession: BC078087
GI: 50415417
Clone ID: ankra2-800
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGACGAAGTCAAATGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTGCTTCTCTGAAACGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556