Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17264397

Xenopus ORFeome
What is the ORFeome?

ORF Name:ap2m1.L ORF1 Species: laevis
Gene Symbol: ap2m1.L Entrez Gene ID: 380497
Gene Synonyms: clapm1
Gene Name: adaptor related protein complex 2 subunit mu 1
Description:
Plate: GDExl11012 Well: B06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824023
3' ORF Sequence: JZ829331
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis adaptor-related protein complex 2, mu 1 subunit, mRNA (cDNA clone MGC:53076 IMAGE:5542078), complete cds
Template Accession: BC047969
GI: 28839635
Clone ID: IMAGE:5542078
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTGGAGGACTGTTCATATAT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACACCGTGTCTCATAGATCC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers