Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17264481

Xenopus ORFeome
What is the ORFeome?

ORF Name:apex2.L ORF1 Species: laevis
Gene Symbol: apex2.L Entrez Gene ID: 446614
Gene Synonyms: ape2, apexl2, xth2
Gene Name: apurinic/apyrimidinic endodeoxyribonuclease 2
Description: DNA repair
Plate: GDExl11029 Well: C08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825706
3' ORF Sequence: JZ825707
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis APEX nuclease (apurinic/apyrimidinic endonuclease) 2, mRNA (cDNA clone MGC:82216 IMAGE:4030411), complete cds
Template Accession: BC077433
GI: 50415221
Clone ID: IMAGE:4030411
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGATTGTGAGCTGGAAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCTCACATCCAGCTTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556