Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17265027

Xenopus ORFeome
What is the ORFeome?

ORF Name:arnt.S ORF1 Species: laevis
Gene Symbol: arnt.S Entrez Gene ID: 399025
Gene Synonyms: arnt1, hif1beta, xarnt
Gene Name: aryl hydrocarbon receptor nuclear translocator
Description: transcription factor
Plate: GDExl11023 Well: H03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824914
3' ORF Sequence: JZ830283
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: unknown
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis aryl hydrocarbon receptor nuclear translocator 2, mRNA (cDNA clone MGC:68805 IMAGE:4203590), complete cds
Template Accession: BC061940
GI: 38303807
Clone ID: IMAGE:4203590
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCATCTGATGTCCCAGCTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAGCAAATGACTGGAAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers