Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17265135

Xenopus ORFeome
What is the ORFeome?

ORF Name:arsa.1.S ORF1 Species: laevis
Gene Symbol: arsa.1.S Entrez Gene ID: 447252
Gene Synonyms: arylsulfatase a, mld
Gene Name: arylsulfatase A, gene 1
Description: sulfatase
Plate: GDExl11075 Well: F10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ835894
3' ORF Sequence: JZ835895
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC86251 protein, mRNA (cDNA clone MGC:86251 IMAGE:6959676), complete cds
Template Accession: BC079772
GI: 50927223
Clone ID: IMAGE:6959676
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGTCTGGTACATCATCTTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGAAAGATCTCTTCTTCTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556