Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17265279

Xenopus ORFeome
What is the ORFeome?

ORF Name:ass1.S ORF1 Species: laevis
Gene Symbol: ass1.L Entrez Gene ID: 380488
Gene Synonyms: ass
Gene Name: argininosuccinate synthase 1
Description: Argininosuccinate synthase
Plate: GDExl11018 Well: H05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824420
3' ORF Sequence: JZ829777
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: BC046941.1 Xenopus laevis arginosuccinate synthetase 1, mRNA (cDNA clone MGC:53519 IMAGE:5572657), complete cds
Template Accession: BC046941
GI: 28422223
Clone ID: IMAGE:5572657
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCCAAAGTAAAGGTACAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTTGTTCTTTTGAAGCCGGTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers