Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17265777

Xenopus ORFeome
What is the ORFeome?

ORF Name:aurka.L ORF1 Species: laevis
Gene Symbol: aurka.L Entrez Gene ID: 397925
Gene Synonyms: aik, ark1, aur-a, aura, aurora a, aurora-a, aurora2, btak, eg2, peg2, stk15, stk6, stk7
Gene Name: aurora kinase A
Description: serine/threonine kinase
Plate: GDExl11044 Well: D09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ830532
3' ORF Sequence: JZ830533
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis p46Eg265, mRNA (cDNA clone MGC:79968 IMAGE:6318106), complete cds
Template Accession: BC072133
GI: 48735037
Clone ID: IMAGE:6318106
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCGGGCTGTTAAGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGGGCGCCTGGAAGGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers