Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17265867

Xenopus ORFeome

ORF Name:b3gnt5 ORF2 Species: laevis
Gene Symbol: b3gnt5.L Entrez Gene ID: 496364
Gene Synonyms: b3gn-t5, b3gnt5-a, b3gnt5-b, beta3gn-t5
Gene Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Description: Galactosyltransferases
Plate: GDExl11081 Well: H05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ836909
3' ORF Sequence: JZ836910
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5, mRNA (cDNA clone MGC:85152 IMAGE:6869583), complete cds
Template Accession: BC088967
GI: 57033043
Clone ID: MGC:85152 IMAGE:6869583
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTATTAGTGCTAGGAGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGACCATGCAGCTGAACAGGGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556