Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17265903

Xenopus ORFeome

ORF Name:b4galt7 ORF1 Species: laevis
Gene Symbol: b4galt7.S Entrez Gene ID: 495369
Gene Synonyms:
Gene Name: xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
Description: Beta-1,4-galactosyltransferase B4GALT7/SQV-3
Plate: GDExl11006 Well: C03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ840032
3' ORF Sequence: JZ840031
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: no
Original XGC clone QC Flag: yes



Template Information
Description: Xenopus laevis hypothetical LOC495369, mRNA (cDNA clone MGC:85363 IMAGE:6879817), complete cds
Template Accession: BC084833
GI: 54311253
Clone ID: MGC:85363 IMAGE:6879817
Tissue: whole organism
Stage: NF stage 53
Clone Library: NICHD_XGC_Tad1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTATATGACACGGAGAAAGCCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTAAAGACACACCATGGTGTGTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556