Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17265909

Xenopus ORFeome

ORF Name:b9d1 ORF1 Species: laevis
Gene Symbol: b9d1.L Entrez Gene ID: 446392
Gene Synonyms:
Gene Name: B9 protein domain 1
Description: Uncharacterized conserved protein
Plate: GDExl11053 Well: C11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ832012
3' ORF Sequence: JZ832013
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC83744 protein, mRNA (cDNA clone MGC:83744 IMAGE:6640120), complete cds
Template Accession: BC076802
GI: 49899787
Clone ID: MGC:83744 IMAGE:6640120
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCTCAGGGCCCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGCTGGGGCATTAGCTGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556