Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17265939

Xenopus ORFeome

ORF Name:baf-l ORF1 Species: laevis
Gene Symbol: baf-l.L Entrez Gene ID: 496357
Gene Synonyms:
Gene Name: barrier-to-autointegration factor-like protein
Description: DNA-bridging protein BAF
Plate: GDExl11080 Well: A09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ836954
3' ORF Sequence: JZ836953
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC496357, mRNA (cDNA clone MGC:85105 IMAGE:6867821), complete cds
Template Accession: BC088959
GI: 57032562
Clone ID: MGC:85105 IMAGE:6867821
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTAATACTTCTCAGAAGCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAAAGGACGAGCACCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556