Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17266713

Xenopus ORFeome

ORF Name:c10orf11 ORF1 Species: laevis
Gene Symbol: lrmda.L Entrez Gene ID: 735174
Gene Synonyms: c10orf11
Gene Name: leucine rich melanocyte differentiation associated
Description: protein coding
Plate: GDExl11065 Well: A02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ833943
3' ORF Sequence: JZ833944
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC130937, mRNA (cDNA clone MGC:130937 IMAGE:7393991), complete cds
Template Accession: BC106374
GI: 76779726
Clone ID: MGC:130937 IMAGE:7393991
Tissue: testis
Stage: frog
Clone Library: NICHD_XGC_Te2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGGAGACGCTGTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGCTGGTCATCACGAATGAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556