Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17266719

Xenopus ORFeome

ORF Name:c10orf137 ORF1 Species: laevis
Gene Symbol: edrf1.S Entrez Gene ID: 432052
Gene Synonyms:
Gene Name: erythroid differentiation regulatory factor 1
Description:
Plate: GDExl11044 Well: E02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ828343
3' ORF Sequence: JZ828342
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: medium
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC83145, mRNA (cDNA clone MGC:83145 IMAGE:6318912), complete cds
Template Accession: BC070691
GI: 47682294
Clone ID: MGC:83145 IMAGE:6318912
Tissue: ovary
Stage: frog
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGACAGCGACGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACGGAGGCGTCAGCTGAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556