Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17266737

Xenopus ORFeome

ORF Name:armh3.L ORF1 Species: laevis
Gene Symbol: armh3.L Entrez Gene ID: 446861
Gene Synonyms: c10orf76
Gene Name: armadillo-like helical domain containing 3
Description: Uncharacterized conserved protein
Plate: GDExl11042 Well: H08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: No sequence available
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80822 protein, mRNA (cDNA clone MGC:80822 IMAGE:5513918), complete cds
Template Accession: BC077914
GI: 50415005
Clone ID: MGC:80822 IMAGE:5513918
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGCTGAAAGATAACATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAAATGGTGGAGAACTCTTTCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556