Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17266749

Xenopus ORFeome

ORF Name:c11orf54 ORF1 Species: laevis
Gene Symbol: c11orf54.L Entrez Gene ID: 444476
Gene Synonyms:
Gene Name: chromosome 11 open reading frame 54
Description: Uncharacterized conserved protein
Plate: GDExl11049 Well: F12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ831532
3' ORF Sequence: JZ831533
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC81809 protein, mRNA (cDNA clone MGC:81809 IMAGE:7007885), complete cds
Template Accession: BC074124
GI: 49257561
Clone ID: MGC:81809 IMAGE:7007885
Tissue: mesonephric kidney
Stage: frog
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAACTGAGAGCTGCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCCCTTCCAACCAAGTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556