Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17267799

Xenopus ORFeome
What is the ORFeome?

ORF Name:cav1.L ORF1 Species: laevis
Gene Symbol: cav1.L Entrez Gene ID: 398392
Gene Synonyms: bscl3, cav-1, cav1-a, cav1-b, caveolin-1, cgl3, vip21
Gene Name: caveolin 1
Description: caveolar plasma membrane protein
Plate: GDExl11030 Well: B05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825898
3' ORF Sequence: JZ825897
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis caveolin 1, caveolae protein, 22kDa, mRNA (cDNA clone MGC:82318 IMAGE:4056787), complete cds
Template Accession: BC070672
GI: 47682588
Clone ID: IMAGE:4056787
Tissue: lung
Stage:
Clone Library: NICHD_XGC_Lu1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGGTGGCAAATACATAGAT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTCTTTGCGTAAGGAAATC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556