Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17268087

Xenopus ORFeome
What is the ORFeome?

ORF Name:washc3.L ORF1 Species: laevis
Gene Symbol: washc3.L Entrez Gene ID: 444750
Gene Synonyms: ccdc53
Gene Name: WASH complex subunit 3
Description: Predicted coiled-coil protein
Plate: GDExl11056 Well: G08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ832488
3' ORF Sequence: JZ832489
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84788 protein, mRNA (cDNA clone MGC:84788 IMAGE:6952079), complete cds
Template Accession: BC074483
GI: 49522790
Clone ID: IMAGE:6952079
Tissue: brain
Stage:
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGAGGACGGGCTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCACTGAAGGAAGACTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556