Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17268213

Xenopus ORFeome
What is the ORFeome?

ORF Name:ccnb2.S ORF1 Species: laevis
Gene Symbol: ccnb2.S Entrez Gene ID: 397743
Gene Synonyms: c-b2, cyclin b2, cyclinb2
Gene Name: cyclin B2
Description: cell cycle regulator
Plate: GDExl11073 Well: G04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ835490
3' ORF Sequence: JZ835491
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis C-B2, mRNA (cDNA clone MGC:114711 IMAGE:6636279), complete cds
Template Accession: BC100180
GI: 71681242
Clone ID: IMAGE:6636279
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACTCGTCGCGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAGAGACTTGCAGCAAGCTCTGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556