Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17268255

Xenopus ORFeome
What is the ORFeome?

ORF Name:ccnd2.S ORF1 Species: laevis
Gene Symbol: ccnd2.S Entrez Gene ID: 734882
Gene Synonyms: ccnd2-a, ccnd2-b
Gene Name: cyclin D2
Description: G1/S-specific cell cycle regulator
Plate: GDExl11083 Well: A02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837194
3' ORF Sequence: JZ837193
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC132398, mRNA (cDNA clone MGC:132398 IMAGE:5156257), complete cds
Template Accession: BC106703
GI: 76779694
Clone ID: IMAGE:5156257
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACTGCTGTGCTGCGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGTTGATGTCCTGCAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers