Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17268459

Xenopus ORFeome
What is the ORFeome?

ORF Name:cd2ap.L ORF1 Species: laevis
Gene Symbol: cd2ap.L Entrez Gene ID: 445851
Gene Synonyms:
Gene Name: CD2-associated protein
Description: Adaptor protein CMS/SETA
Plate: GDExl11076 Well: F06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836084
3' ORF Sequence: JZ836085
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC445851, mRNA (cDNA clone MGC:114985 IMAGE:5084120), complete cds
Template Accession: BC097671
GI: 66911533
Clone ID: IMAGE:5084120
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGAATACATTGTGGAATAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTTAACTGGACCGCCTTCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers