Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17268765

Xenopus ORFeome
What is the ORFeome?

ORF Name:cdk1.L ORF1 Species: laevis
Gene Symbol: cdk1.L Entrez Gene ID: 379785
Gene Synonyms: cdc-2, cdc2, cdc28a, cdc2x1.1, cdk1-a, cdk1-b, cell division control protein 2 homolog, maturation-promoting factor, mpf, p34cdc2, pstair, xcdc2
Gene Name: cyclin-dependent kinase 1
Description: serine/threonine kinase
Plate: GDExl11002 Well: A01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839265
3' ORF Sequence: JZ839264
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cell division cycle 2 homolog A (S. pombe), mRNA (cDNA clone MGC:64249 IMAGE:6878353), complete cds
Template Accession: BC054146
GI: 32450028
Clone ID: IMAGE:6878353
Tissue: whole organism
Stage: NF stage 54 to prometamorphosis stage
Clone Library: NICHD_XGC_Tad1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGAGTACACTAAAATAGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTTCTAATCTGATTGGCGGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556