Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17268837

Xenopus ORFeome
What is the ORFeome?

ORF Name:cdk4.L ORF1 Species: laevis
Gene Symbol: cdk4.S Entrez Gene ID: 379406
Gene Synonyms: xcdk4
Gene Name: cyclin-dependent kinase 4
Description: serine/threonine kinase
Plate: GDExl11012 Well: F10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824006
3' ORF Sequence: JZ829314
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC52574, mRNA (cDNA clone MGC:52574 IMAGE:5542266), complete cds
Template Accession: BC051599
GI: 30185633
Clone ID: cdk4-879
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAAAAGAAATGAAGGGTCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCACTTCATCCGTTGCG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556