Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17268879

Xenopus ORFeome
What is the ORFeome?

ORF Name:cdk8.S ORF1 Species: laevis
Gene Symbol: cdk8.S Entrez Gene ID: 447409
Gene Synonyms:
Gene Name: cyclin-dependent kinase 8
Description: Cyclin C-dependent kinase CDK8
Plate: GDExl11049 Well: B11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831560
3' ORF Sequence: JZ831561
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC81962 protein, mRNA (cDNA clone MGC:81962 IMAGE:7010196), complete cds
Template Accession: BC080386
GI: 51512993
Clone ID: IMAGE:7010196
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACTATGACTTCAAGGTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACCGGTGAGTCTGATG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers