Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17269065

Xenopus ORFeome
What is the ORFeome?

ORF Name:celf1.S ORF1 Species: laevis
Gene Symbol: celf1.S Entrez Gene ID: 379661
Gene Synonyms: brunol2, celf1-a, celf1-b, cug-bp, cug-bp1, cugbp, cugbp1, eden-bp, edenbp, embryo deadenylation element binding protein, nab50
Gene Name: CUGBP Elav-like family member 1
Description: mediation of sequence-specific mRNA deadenylation
Plate: GDExl11020 Well: G02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824594
3' ORF Sequence: JZ829945
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis CUG-BP- and ETR-3-like factor 1-B, mRNA (cDNA clone MGC:69034 IMAGE:4964741), complete cds
Template Accession: BC057743
GI: 34784677
Clone ID: IMAGE:4964741
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATGGCACAATGGACCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACGGTTTGCTGTCATTCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers