Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17269077

Xenopus ORFeome
What is the ORFeome?

ORF Name:celf1.L ORF1 Species: laevis
Gene Symbol: celf1.L Entrez Gene ID: 399360
Gene Synonyms: brunol2, celf1-a, celf1-b, cug-bp, cug-bp1, cugbp, cugbp1, eden-bp, edenbp, embryo deadenylation element binding protein, nab50
Gene Name: CUGBP Elav-like family member 1
Description: mediation of sequence-specific mRNA deadenylation
Plate: GDExl11087 Well: D04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838015
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis embryo deadenylation element binding protein, mRNA (cDNA clone MGC:131066 IMAGE:7981456), complete cds
Template Accession: BC108574
GI: 80478528
Clone ID: IMAGE:7981456
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATGGCACAATGGACCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGGGTTTGCTGTCATTCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers