Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17269209

Xenopus ORFeome
What is the ORFeome?

ORF Name:cer1.S ORF1 Species: laevis
Gene Symbol: cer1.S Entrez Gene ID: 398060
Gene Synonyms: cer, cer-1, cerberus, dand4, tcerberus, xcer, xcer-1, xcer1
Gene Name: cerberus 1, DAN family BMP antagonist
Description: secreted BMP antagonist
Plate: GDExl11051 Well: F04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831693
3' ORF Sequence: JZ831694
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cerberus, mRNA (cDNA clone MGC:86494 IMAGE:6864787), complete cds
Template Accession: BC081277
GI: 51703714
Clone ID: IMAGE:6864787
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACAAAGTCAAGCTTTTCTCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGGTGCAGGGTAGTAGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556