Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17269515

Xenopus ORFeome
What is the ORFeome?

ORF Name:chrd.1.S ORF1 Species: laevis
Gene Symbol: chrd.1.S Entrez Gene ID: 398045
Gene Synonyms: chd, chordin, chrd, x-chordin
Gene Name: chordin, gene 1
Description: extracellular BMP antagonist, dorsalizing factor
Plate: GDExl11037 Well: G04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827178
3' ORF Sequence: JZ827177
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis chordin, mRNA (cDNA clone MGC:79971 IMAGE:5161617), complete cds
Template Accession: BC077767
GI: 50414701
Clone ID: IMAGE:5161617
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGTGTCCCCCCATCCTACTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAACTCCATGGAGTCCTTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556